cas9 expression plasmid Search Results


99
Integrated DNA Technologies constitutive cas9 expression
( A ) RT-PCR for MEIS1 (black) or pan- MEIS2 (gray) in five of the most common prostate cancer cell lines (LNCaP, CWR22Rv1, LAPC4, Du145, and PC3) as compared to non-malignant primary prostate epithelial cells (PrECs). Fold-change from PrEC was calculated using ΔΔCq methodology (technical replicates, n = 3). Error bars represent standard error of the mean (SEM). ( B ) Western blot analysis of endogenous MEIS1, MEIS2, and HOXB13 expression from common prostate cancer cell lines and primary Prostate Epithelial Cell (PrEC) culture. Actin was used as a loading control. ( C ) Western blot confirmation of lentiviral overexpression of MEIS1 or MEIS2 in CWR22Rv1 and LAPC4 cell lines. LV-Control encodes an expression plasmid for constitutive <t>Cas9</t> expression. Endogenous HOXB13 expression was also assessed in all lines. Actin was used as a loading control. ( D ) Proliferation of CWR22Rv1 (top) and LAPC4 (bottom) with exogenous expression of MEIS1 (blue), MEIS2A (red), or control (black). Cell number over time was assessed by manual counting of live cells on a hemocytometer. Data represent mean count and SEM at each time point (technical replicates, n = 3). Data for LV-Control and LV-MEIS2A is the same as in ( E ) Cell cycle analysis determined by propidium iodide (PI) fluorescence intensity in CWR22Rv1 and LAPC4 cells with exogenous expression of MEIS1 (blue), MEIS2A (red), or control (black). Data represent mean (technical replicates, n = 3) and SEM. ( F ) Representative tumors fixed at time of sacrifice. Tumors are subcutaneous xenografts of CWR22Rv1 cells with exogenous expression of MEIS1, MEIS2A, or control. ( G ) Subcutaneous tumor growth over time for CWR22Rv1 cells with exogenous expression of MEIS1 (blue), MEIS2A (red), or control (black). Data points represent mean (n = 19 for each cell type) and SEM. ( H ) Representative images of transwell migration assays for CWR22Rv1 (top) and LAPC4 (bottom) of cells with exogenous expression of control (left) or MEIS1 (right). ( I ) Quantification of transwell migrations performed in ( H ). Data represent mean (technical replicates, n = 4) and SEM. *Student’s t-test p<0.05 for all panels. See also and .
Constitutive Cas9 Expression, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cas9+expression+plasmid/Cas9+Expression+Plasmid/pmc07371429-236-3-9
Average 99 stars, based on 1 article reviews
constitutive cas9 expression - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

94
Genecopoeia sgrna/cas9 all-in-one expression clones targeting trap1
( A ) RT-PCR for MEIS1 (black) or pan- MEIS2 (gray) in five of the most common prostate cancer cell lines (LNCaP, CWR22Rv1, LAPC4, Du145, and PC3) as compared to non-malignant primary prostate epithelial cells (PrECs). Fold-change from PrEC was calculated using ΔΔCq methodology (technical replicates, n = 3). Error bars represent standard error of the mean (SEM). ( B ) Western blot analysis of endogenous MEIS1, MEIS2, and HOXB13 expression from common prostate cancer cell lines and primary Prostate Epithelial Cell (PrEC) culture. Actin was used as a loading control. ( C ) Western blot confirmation of lentiviral overexpression of MEIS1 or MEIS2 in CWR22Rv1 and LAPC4 cell lines. LV-Control encodes an expression plasmid for constitutive <t>Cas9</t> expression. Endogenous HOXB13 expression was also assessed in all lines. Actin was used as a loading control. ( D ) Proliferation of CWR22Rv1 (top) and LAPC4 (bottom) with exogenous expression of MEIS1 (blue), MEIS2A (red), or control (black). Cell number over time was assessed by manual counting of live cells on a hemocytometer. Data represent mean count and SEM at each time point (technical replicates, n = 3). Data for LV-Control and LV-MEIS2A is the same as in ( E ) Cell cycle analysis determined by propidium iodide (PI) fluorescence intensity in CWR22Rv1 and LAPC4 cells with exogenous expression of MEIS1 (blue), MEIS2A (red), or control (black). Data represent mean (technical replicates, n = 3) and SEM. ( F ) Representative tumors fixed at time of sacrifice. Tumors are subcutaneous xenografts of CWR22Rv1 cells with exogenous expression of MEIS1, MEIS2A, or control. ( G ) Subcutaneous tumor growth over time for CWR22Rv1 cells with exogenous expression of MEIS1 (blue), MEIS2A (red), or control (black). Data points represent mean (n = 19 for each cell type) and SEM. ( H ) Representative images of transwell migration assays for CWR22Rv1 (top) and LAPC4 (bottom) of cells with exogenous expression of control (left) or MEIS1 (right). ( I ) Quantification of transwell migrations performed in ( H ). Data represent mean (technical replicates, n = 4) and SEM. *Student’s t-test p<0.05 for all panels. See also and .
Sgrna/Cas9 All In One Expression Clones Targeting Trap1, supplied by Genecopoeia, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cas9+expression+plasmid/sgRNA%2FCas9+all-in-one+expression+clones+targeting+TRAP1/custom%40hcp367623-cg04-3-10%4031987035
Average 94 stars, based on 1 article reviews
sgrna/cas9 all-in-one expression clones targeting trap1 - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

Image Search Results


( A ) RT-PCR for MEIS1 (black) or pan- MEIS2 (gray) in five of the most common prostate cancer cell lines (LNCaP, CWR22Rv1, LAPC4, Du145, and PC3) as compared to non-malignant primary prostate epithelial cells (PrECs). Fold-change from PrEC was calculated using ΔΔCq methodology (technical replicates, n = 3). Error bars represent standard error of the mean (SEM). ( B ) Western blot analysis of endogenous MEIS1, MEIS2, and HOXB13 expression from common prostate cancer cell lines and primary Prostate Epithelial Cell (PrEC) culture. Actin was used as a loading control. ( C ) Western blot confirmation of lentiviral overexpression of MEIS1 or MEIS2 in CWR22Rv1 and LAPC4 cell lines. LV-Control encodes an expression plasmid for constitutive Cas9 expression. Endogenous HOXB13 expression was also assessed in all lines. Actin was used as a loading control. ( D ) Proliferation of CWR22Rv1 (top) and LAPC4 (bottom) with exogenous expression of MEIS1 (blue), MEIS2A (red), or control (black). Cell number over time was assessed by manual counting of live cells on a hemocytometer. Data represent mean count and SEM at each time point (technical replicates, n = 3). Data for LV-Control and LV-MEIS2A is the same as in ( E ) Cell cycle analysis determined by propidium iodide (PI) fluorescence intensity in CWR22Rv1 and LAPC4 cells with exogenous expression of MEIS1 (blue), MEIS2A (red), or control (black). Data represent mean (technical replicates, n = 3) and SEM. ( F ) Representative tumors fixed at time of sacrifice. Tumors are subcutaneous xenografts of CWR22Rv1 cells with exogenous expression of MEIS1, MEIS2A, or control. ( G ) Subcutaneous tumor growth over time for CWR22Rv1 cells with exogenous expression of MEIS1 (blue), MEIS2A (red), or control (black). Data points represent mean (n = 19 for each cell type) and SEM. ( H ) Representative images of transwell migration assays for CWR22Rv1 (top) and LAPC4 (bottom) of cells with exogenous expression of control (left) or MEIS1 (right). ( I ) Quantification of transwell migrations performed in ( H ). Data represent mean (technical replicates, n = 4) and SEM. *Student’s t-test p<0.05 for all panels. See also and .

Journal: eLife

Article Title: MEIS-mediated suppression of human prostate cancer growth and metastasis through HOXB13-dependent regulation of proteoglycans

doi: 10.7554/eLife.53600

Figure Lengend Snippet: ( A ) RT-PCR for MEIS1 (black) or pan- MEIS2 (gray) in five of the most common prostate cancer cell lines (LNCaP, CWR22Rv1, LAPC4, Du145, and PC3) as compared to non-malignant primary prostate epithelial cells (PrECs). Fold-change from PrEC was calculated using ΔΔCq methodology (technical replicates, n = 3). Error bars represent standard error of the mean (SEM). ( B ) Western blot analysis of endogenous MEIS1, MEIS2, and HOXB13 expression from common prostate cancer cell lines and primary Prostate Epithelial Cell (PrEC) culture. Actin was used as a loading control. ( C ) Western blot confirmation of lentiviral overexpression of MEIS1 or MEIS2 in CWR22Rv1 and LAPC4 cell lines. LV-Control encodes an expression plasmid for constitutive Cas9 expression. Endogenous HOXB13 expression was also assessed in all lines. Actin was used as a loading control. ( D ) Proliferation of CWR22Rv1 (top) and LAPC4 (bottom) with exogenous expression of MEIS1 (blue), MEIS2A (red), or control (black). Cell number over time was assessed by manual counting of live cells on a hemocytometer. Data represent mean count and SEM at each time point (technical replicates, n = 3). Data for LV-Control and LV-MEIS2A is the same as in ( E ) Cell cycle analysis determined by propidium iodide (PI) fluorescence intensity in CWR22Rv1 and LAPC4 cells with exogenous expression of MEIS1 (blue), MEIS2A (red), or control (black). Data represent mean (technical replicates, n = 3) and SEM. ( F ) Representative tumors fixed at time of sacrifice. Tumors are subcutaneous xenografts of CWR22Rv1 cells with exogenous expression of MEIS1, MEIS2A, or control. ( G ) Subcutaneous tumor growth over time for CWR22Rv1 cells with exogenous expression of MEIS1 (blue), MEIS2A (red), or control (black). Data points represent mean (n = 19 for each cell type) and SEM. ( H ) Representative images of transwell migration assays for CWR22Rv1 (top) and LAPC4 (bottom) of cells with exogenous expression of control (left) or MEIS1 (right). ( I ) Quantification of transwell migrations performed in ( H ). Data represent mean (technical replicates, n = 4) and SEM. *Student’s t-test p<0.05 for all panels. See also and .

Article Snippet: After confirmation of constitutive Cas9 expression, a custom crRNA (IDT) targeting the N-terminus of HOXB13 was selected using CHOPCHOP software (HOXB13 crRNA: 5’- TTGACAGCAGGCATCAGCGT -3’) and was annealed with the tracrRNA-ATTO 550 (#1075927, IDT) according to manufacturer guidelines.

Techniques: Reverse Transcription Polymerase Chain Reaction, Western Blot, Expressing, Over Expression, Plasmid Preparation, Cell Cycle Assay, Fluorescence, Migration